Part:BBa_K1440066

reverse CMV->reverse RFP->pTRE->shRNA

this part consists of reverse CMV and reverse RFP and tet-on shRFP system. With the transfection of this plasmid into the cell lines, RFP will be expressed constitutely. if dox is dosed with the cell lines, shRFP will be expressed, then knockdown the RFP expression.It must be used in mammalian cells.

Design Notes

It is a component of our whole project,can work individually.

Brief

This is a component of our whole project, cannot perform complex logic calculation individually. The whole project we carried out is to construct a circuit capable of performing multiple parallel logic calculation. There are 3 reporter gene in the complete project, response to 3 permutations of two input signals -- Tet & TM. We designed two different models based on two distinct enzymatic activity of Cre recombinase, namely sequence excision activity and sequence inversion activity. We mainly focus on constructing “excision-model” , through divide this model into three tandem parts and constructed them separately. This is the third part, contains a constitutive expressed reporter and a Tet-inducible shRNA targeting this reporter gene.

Excision Model

TM is a drug that can activate CreER fusion recombinase which can recognize loxP site and modify DNA sequence directly. When two loxP sites point the same direction, Cre recombinase will execute excision activity by removing the sequence between two loxP. Based on that, we designed the excision model as shown below.

alt text

This model response to 3 different input states of 2 input drugs, Tet & TM. In this model, CFP, RFP, YFP will express and only express in high-[Tet]-low-[TM], low-[Tet]-high-[TM], high-[Tet]-high-[TM] conditions correspondingly.

Role of this Part

This part is the third part of the whole project, ranging from RFP reporter to the end. Reporter gene is constitutively expressed by CMV promoter. We put this reporter and CMV promoter in an anti-sense direction in order to connect it to the “part 2” biobrick we registered. The shRNA targeting this reporter is placed behind a Tet-inducible promoter. This promoter is derived from Pol III promoter H1T0, modified by adding 2 tetO regulatory unit. When Tet (or Dox) is added, TetR will drop off from its binding site tetO, only then will this Pol III promoter express its downstream shRNA. shRNA will undergo microRNA genesis and end up a siRNA knocking down its targeting gene.

This is the testing result of part 3. Here we show copGFP knock down data rather than RFP (a kind of RFP on our part3 biobrick), because RFP’s effciency is not good as we think of. We use CMV-RFP plasmid to test the efficiency of RFP, finding that RFP can not even work. so we decide use copGFP instead in Part3.

We use Lipofactine 2000 as the transfection reagent to do transient transfection. We transfect part3 (RFP replaced by copGFP) with tetR plasmid together in the HEK293 cells in 24-well cell dish. After 6 hrs transfection, we dose the each cell plate with certain concentration of doxycycline. And figure (1) shows 36hrs cells’ condition which shows that our part 3 works well.

For this part’s testing, we find [Dox] less then 1ug/ml is sufficient enough to knock down GFP while “control” cell plate show high copGFP transfection efficiency, demonstrating that our transfection efficiency is quite good. And we use blood cell counting chamber to count the GFP positive cell numbers and total cell numbers. We use “GFP positive cell number/ total cell number” to indicate the efficiency of our system. We normolize each tet-on-work cell plate to control cell plate, and draw figure (2) as our final knock down result.

shRNA sequence used: Forward: CCGGGCCGCATGACCAACAAGATGACTCGAGTCATCTTGTTGGTCATGCGGCTTTTT Reverse: AATTAAAAAGCCGCATGACCAACAAGATGACTCGAGTCATCTTGTTGGTCATGCGGC

Source

BBa_K774007 (RFP) BBa_K678012 (SV40pA) BBa_K747096 (CMV promoter)

References

3.Benson, J.D. et.al. (2009). “Single-vector inducible lentiviral RNAi system for oncology target validation”. Cell Cycle. 8: 498-504.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal EcoRI site found at 1184
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 1184
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 1184
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal EcoRI site found at 1184
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal EcoRI site found at 1184
  Illegal AgeI site found at 13
  Illegal AgeI site found at 125
  Illegal AgeI site found at 1116
  
• 1000
  COMPATIBLE WITH RFC[1000]